cead20136

quarta-feira, 23 de novembro de 2016

Gene - funções Código genético e síntese de proteínas

Colégio Estadual Dinah Gonçalves
email accbarroso@hotmail.com



Os cromossomos são constituídos por um longo filamento de DNA associado a certas proteínas chamadas histonas. Alguns trechos do DNA presente nesses cromossomos dão início a processos de fabricação de proteínas com as mais diversas funções no organismo. Esses trechos de DNA são o que chamamos de genes.

Quanto ao RNA, cujos nucleotídios se agrupam numa cadeia simples, seus diferentes tipos também participam dos processos de síntese proteica, cada um apresentando diferentes funções.

Os genes e o processo da transcrição
O início da síntese de uma proteína se dá quando um determinado trecho de DNA, um gene, tem suas duas cadeias separadas pela ação de uma enzima chamada polimerase do RNA, que também orienta o agrupamento de nucleotídios livres no núcleo, junto a uma dessas cadeias. Esses nucleotídios unem-se, formando, então, uma molécula de RNA.

Os nucleotídios agrupam-se segundo um emparelhamento de bases nitrogenadas parecido com aquele das duas cadeias do DNA, com a diferença de que a adenina se emparelha com a uracila (A - U). Dessa forma, se a sequência de bases nitrogenadas do DNA for, por exemplo, TACAATCGCATTCAGGTACTG, a sequência de bases do RNA formado será AUGUUAGCGUAAGUCCAUGAC.


Esquema do processo de transcrição gênica.


A sequência de bases transcritas a partir do DNA carrega consigo a informação codificada para a construção de uma molécula de proteína. Essa codificação se dá na forma de trincas de bases nitrogenadas, chamadas códons. No nosso exemplo, o RNAm formado possui os seguintes códons: AUG, UUA, GCG, UAA, GUC, CAU, GAC.

As proteínas são moléculas formadas por uma sequência de unidades menores chamadas aminoácidos. Como veremos mais adiante, os códons do RNA formado neste processo determinam os aminoácidos que constituirão uma determinada molécula de proteína. Eles contêm, portanto, uma mensagem para a síntese proteica e, por isso, esse RNA recebeu o nome de "mensageiro".

O processo da tradução gênica
A etapa seguinte da síntese proteica ocorre no citoplasma das células onde o RNAm formado acopla-se a organelas chamadas ribossomos, que são constituídas por RNAr associado a proteínas. É nos ribossomos que ocorre a síntese e eles podem encontrar-se livres no citoplasma ou associados ao retículo endoplasmático rugoso.
Entra em ação, então, o terceiro tipo de RNA, o RNA transportador, que recebe esse nome em virtude de transportar com ele os aminoácidos, as unidades constituintes das proteínas. No RNAt há uma trinca de bases nitrogenadas denominadas anticódon, por meio das quais ele se liga temporariamente ao RNAm no ribossomo pelas bases complementares (códon).

Assim, no caso da sequência do exemplo dado anteriormente (AUGUUAGCGUAAGUCCAUGAC), às três primeiras bases (AUG) vai acoplar-se um RNAt com a sequência UAC; e assim por diante, como no esquema abaixo:

Página 3


A síntese de uma proteína começa com o acoplamento do ribossomo ao RNAm. No ribossomo também se acopla um RNAt, cujo anticódon se liga ao códon do RNAm. Logo em seguida, outro RNAt acopla-se ao segundo códon, ou seja, um ribossomo permite que até dois RNAts se acoplem ao mesmo tempo.

Os aminoácidos transportados em cada RNAt unem-se entre si por meio de uma ligação química conhecida por ligação peptídica. O ribossomo, que catalisa esse processo, desloca-se então sobre o RNAm e o primeiro RNAt se desliga do conjunto ribossomo-RNAm, sendo que os aminoácidos permanecem ligados.

Em seguida, uma nova molécula de RNAt se une ao ribossomo, transportando mais um aminoácido que se junta aos outros dois. O processo continua até que todos os códons do RNAm tenham sido percorridos pelo ribossomo, recebendo os RNAt complementares e formando uma cadeia de aminoácidos, ou seja, uma molécula de proteína.

Esquema do processo de tradução gênica. A estrutura de cor azul claro é o ribossomo.


O código genético
Todas as proteínas presentes nos mais diferentes seres vivos são compostas por combinações entre 20 aminoácidos. Essas combinações são determinadas, como vimos, pelas sequências de códons do RNAm que foram transcritas a partir do DNA. Damos o nome de código genético à correspondência entre os códons e os aminoácidos.

Página 3
Código genético: correspondência entre os códons do RNAm e os aminoácidos trazidos pelo RNAt ao local da síntese protéica.


As quatro bases nitrogenadas do RNAm combinam-se, três a três, formando 64 códons que correspondem a apenas 20 aminoácidos. Dois ou mais códons podem estar relacionados a um aminoácido, assim como alguns não correspondem a aminoácido nenhum. Neste último caso, são códons que determinam o término do processo de tradução.

O código genético é praticamente o mesmo para todos os seres vivos e, por isso, dizemos que ele é universal. Além de universal, ele é considerado "degenerado", pois praticamente todos os aminoácidos são determinados por mais de um códon.

Mas qual a relação de tudo o que vimos com as características de um indivíduo? As proteínas têm importantes funções no nosso corpo: são substâncias essenciais para a construção das células dos seres vivos e atuam como enzimas, controlando praticamente todo o metabolismo celular. Portanto, os genes (as porções de DNA que transcrevem RNAm), sendo os responsáveis pelo controle da produção de proteínas, controlam também todas as características dos indivíduos.
Maria Graciete Carramate Lopes

Nenhum comentário:

Postar um comentário