articulador 1

sábado, 25 de abril de 2020

Funções da Linguagem e Comunicação

Colégio Estadual Dinah Gonçalves

Quando um poeta descreve a Lua, suas impressões se dispõem de maneira especial, conforme a subjetividade de suas sensações. Quando um cientista descreve o mesmo objeto, submete-o à interpretação informativa, impessoal e científica. Assim, a Lua, que para o poeta seria “uma inspiração romântica”, para o cientista é “o satélite natural da Terra”.
Dessa forma, temos as funções da linguagem que apontam o direcionamento da mensagem para um ou mais elementos do circuito da comunicação.
Qualquer produção discursiva, lingüística (oral ou escrita) ou extralingüística (pintura, música, fotografia, propaganda, cinema, teatro etc.) apresenta funções da linguagem.
1. Elementos da comunicação
Ao elaborarmos uma redação, precisamos ter em mente que estamos escrevendo para alguém. Enquanto a redação literária destina-se à publicação em jornal, livro ou revista, e seu público é geralmente heterogêneo, a redação para vestibular tem em vista selecionar os candidatos cuja habilidade discursiva toma-os aptos a ingressar na vida acadêmica.
Seja um texto literário ou escolar, a redação sempre apresenta alguém que o escreve, o emissor, e alguém que o lê, o receptor. O que o emissor escreve é a mensagem. O elemento que conduz o discurso para o receptor é o canal (no nosso caso, o canal é o papel). Os fatos, os objetos ou imagens, os juízos ou raciocínios que o emissor expõe ou sobre os quais discorre constituem o referente. A língua que o emissor utiliza (no nosso caso, obrigatoriamente, a língua portuguesa) constitui o código.
Assim, através de um canal, o emissor transmite ao receptor, em um código comum, uma mensagem, que se reporta a um contexto ou referente.
Nesse mecanismo, temos:
o EMISSOR (codificador) elabora uma MENSAGEM,
através de um CÓDIGO,
veiculada por um CANAL
para um RECEPTOR (decodificador).

2. Funções da linguagem
A ênfase num elemento do circuito de comunicação determina a função de linguagem que lhe corresponde:
Cada um desses seis elementos determina uma função de linguagem. Raramente se encontram mensagens em que haja apenas uma; na maioria das vezes o que ocorre é uma hierarquia de funções em que predomina ora uma, ora outra. Observe este trecho:
Escrever é triste. Impede a conjugação de tantos outros verbos. Os dedos sobre o teclado, as letras se reunindo com maior ou menor velocidade, mas com igual indiferença pelo que vão dizendo, enquanto lá fora a vida estoura não só em bombas como também em dádivas de toda natureza, inclusive a simples claridade da hora, vedada a você, que está de olho na maquininha. O mundo deixa de ser realidade quente para se reduzir a marginália, purê de palavras, reflexos no espelho (infiel) do dicionário.
(Carlos Drummond de Andrade)
No exemplo acima, predomina a função metalingüística (volta-se para a própria produção discursiva) e a poética (produz efeito estético através da linguagem metafórica); porém, menos evidentes, aparecem as funções referencial (evidencia o assunto) e emotiva (revela emoções do emissor).
A classificação das funções da linguagem depende das relações estabelecidas entre elas e os elementos do circuito da comunicação. Esquematicamente, temos:
Elementos da comunicação
Função referencial ou denotativa
Certamente a mais comum e mais usada no dia-adia, a função referencial ou informativa, também chamada denotativa ou cognitiva, privilegia o contexto. Ela evidencia o assunto, o objeto, os fatos, os juízos. É a linguagem da comunicação. Faz referência a um contexto, ou seja, a uma informação sem qualquer envolvimento de quem a produz ou de quem a recebe. Não há preocupação com estilo; sua intenção é unicamente informar. E a linguagem das redações escolares, principalmente das .dissertações, das narrações não- fictícias e das descrições objetivas. Caracteriza também o discurso científico, o jornalístico e a correspondência comercial. Exemplo:
Todo brasileiro tem direito à aposentadoria. Mas nem todos têm direitos iguais. Um milhão e meio de funcionários públicos, aposentados por regimes especiais, consomem mais recursos do que os quinze milhões de trabalhadores aposentados pelo INSS. Enquanto a média dos benefícios aos aposentados do INSS é de 2,1 salários mínimos, nos regimes especiais tem gente que ganha mais de 100 salários mínimos.
(Programa Nacional de Desestatização)
Função emotiva ou expressiva
Quando há ênfase no emissor (lª pessoa) e na expressão direta de suas emoções e atitudes, temos a função emotiva, também chamada expressiva ou de exteriorização psíquica. Ela é lingüisticamente representada por interjeições, adjetivos, signos de pontuação (tais como exclamações, reticências) e agressão verbal (insultos, termos de baixo calão), que representam a marca subjetiva de quem fala. Exemplo:
Oh? como és linda, mulher que passas
Que me sacias e suplicias
Dentro das noites, dentro dos dias?

(Vinícius de Moraes)
Observe que em “Luís, você é mesmo um burro!”, a frase perde seu caráter informativo (já que Luís não é uma pessoa transformada em animal) e enfatiza o emotivo, pois revela o estado emocional do emissor..
As canções populares amorosas, as novelas e qualquer expressão artística que deixe transparecer o estado emocional do emissor também pertencem à função emotiva. Exemplos:
E aí me dá uma inveja dessa gente...
(Chico Buarque)
Não adianta nem tentar
Me esquecer
Durante muito tempo em sua vida
Eu vou viver

(Roberto Carlos & Erasmo Carlos)
Sinto que viver é inevitável. Posso na primavera ficar horas sentada fl1mando, apenas sendo. Ser às vezes sangra. Mas não há como não sangrar pois é no sangue que sinto a primavera. Dói. A primavera me dá coisas. Dá do que viver E sinto que um dia na primavera é que vou morrer De amor pungente e coração enfraquecido.
(Clarice Lispector)

Função conativa ou de apelo
A função conativa é aquela que busca mobilizar a atenção do receptor, produzindo um apelo ou uma ordem. Pode ser volitiva, revelando assim uma vontade (“Por favor, eu gostaria que você se retirasse.”), ou imperativa, que é a característica fundamental da propaganda. Encontra no vocativo e no imperativo sua expressão gramatical mais autêntica. Exemplos:
Antônio, venha cá!
Compre um e leve três.
Beba Coca-Cola.
Se o terreno é difícil, use uma solução inteligente:
Função fática
Se a ênfase está no canal, para checar sua recepção ou para manter a conexão entre os falantes, temos a função fática. Nas fórmulas ritualizadas da comunicação, os recursos fáticos são comuns. Exemplos:
Oi, tudo bem?
Ah, é!
Huin... hum...
Alô, quem fala?
Hã, o quê?
Observe os recursos fáticos que, embora característicos da linguagem oral, ganham expressividade na música:
Alô, alô marciano
Aqui quem fala é da Terra.

(Rita Lee & Roberto de Carvalho)
Blá, Blá, Blá, Blá, Blá
Blá, Blá, Blá, Blá
Ti, Ti, Ti, Ti, Ti,
Ti, Ti, Ti, Ti
Tá tudo muito bom, bom!
Tá tudo muito bem, bem!

(Evandro Mesquita)
Atente para o fato de que o uso excessivo dos recursos fáticos denota carência vocabular, já que des
titui a mensagem de carga semântica, mantendo apenas a comunicação, sem traduzir informação. Exemplo:
— Você gostou dos contos de Machado?
— Só, meu. Valeu.
Função metalingüística
A função metalingüística visa à tradução do código ou à elaboração do discurso, seja ele lingüístico (a escrita ou a oralidade), seja extralingüístico (música, cinema, pintura, gestualidade etc. — chamados códigos complexos). Assim, é a mensagem que fala de sua própria produção discursiva. Um livro convertido em filme apresenta um processo de metalinguagem, uma pintura que mostra o próprio artista executando a tela, um poema que fala do ato de escrever, um conto ou romance que discorre sobre a própria linguagem etc. são igualmente metalingüísticos. O dicionário é metalingüístico por excelência. Exemplos:
— Foi assim que sempre se fez. A literatura é a literatura, Seu Paulo. A gente discute, briga, trata de negócios naturalmente, mas arranjar palavras com tinta é outra coisa. Se eu fosse escrever como falo, ninguém me lia.
(Graciliano Ramos)
Lutar com palavras é a luta mais vã. Entanto lutamos mal rompe a manhã.
(Carlos Drummond de Andrade)

A palavra é o homem mesmo, Estamos feitos de palavras. Elas são a única realidade ou, ao menos, o único testemunho de nossa realidade.

(Octávio Paz)
“Anuncie seu produto: a propaganda é a arma do negócio.” Nesse exemplo, temos a função metalingüística (a propaganda fala do ato de anunciar), a conativa (a expressão aliciante do verbo anunciar no imperativo) e a poética (na renovação de um clichê, conferindo-lhe um efeito especial).
Função poética
Quando a mensagem se volta para seu processo de estruturação, para os seus próprios constituintes, tendo em vista produzir um efeito estético, através de desvios da norma ou de combinatórias inovadoras da linguagem, temos a função poética, que pode ocorrer num texto em prosa ou em verso, ou ainda na fotografia, na música, no teatro, no cinema, na pintura, enfim, em qualquer modalidade discursiva que apresente uma maneira especial de elaborar o código, de trabalhar a palavra. Exemplos:
Que não há forma de pensar ou crer
De imaginar sonhar ou de sentir
Nem rasgo de loucura
Que ouse pôr a alma humana frente a frente
Com isso que uma vez visto e sentido
Me mudou, qual ao universo o sol
Falhasse súbito, sem duração
No acabar..

(Fernando Pessoa)
Observe, entretanto, que o discurso desviatório necessita de um contexto para produzir sensação estética, como no poema abaixo, cujo nonsense é altamente poético no contexto de Alice no País das Maravilhas:
Pois então tu mataste o Jaguadarte!
Vem aos meus braços, homenino meu!
Oh dia fremular! Bravooh! Bravarte!
Ele se ria jubileu.
Era briluz. As lesmolisas touvas
Roldavam e relvian nos gramilvos.
Estavam mimsicais as pintalouvas
E os momirratos davam grilvos.

(Lewis Carrol, traduzido por Augusto de Campos.)

Emprego do Hífen

Usa-se o hífen:

1. nas palavras compostas em que os elementos da composição têm acentuação própria e formam uma unidade significativa: guarda-roupa, beija-flor, bem-te-vi;

2. com a partícula denotativa eis seguida de pronome pessoal átono: eis-me, eis-vos, eis-nos, ei-lo (com a queda do s);

3. nos adjetivos compostos: surdo-mudo, afro-brasileiro, sino-luso-brasileiro;

4. nos vocábulos formados pelos sufixos Açu, guaçu e mirim, se o primeiro elemento terminar com uma vogal acentuada graficamente ou for anasalada: sabiá-açu, acará-guaçu, capim-açu;

5. em vocábulos formados pro prefixos que têm acentuação: pré-história, pós-operatório, pró-socialista;

6. com os prefixos do quadro abaixo (mas observe que haverá hífen diante de determinadas letras):

Diante de
auto, contra, extra, intra, infra, neo, proto, pseudo, semi, supra, ultra
vogal, h, r e s
auto-escola, contra-ordem, extra-oficial, intra-renal, infra-som, neo-republicano, proto-revolucionário, pseudo-revelação, semi-selvagem, supra-humano, ultra-som
ante, anti, arqui, sobre, hiper, inter, super
h, r e s
ante-histórico, anti-rábico, ante-sala, anti-higiênico, arqui-rabino, sobre-solar, hiper-sensível, inter-regional, super-homem, sub-raça
b e r
sub-bosque, sub-região
circum, pan, mal
vogal e h
circum-adjacente, pan-americano, mal-educado, mal-humorado
ad, ab, sob
ad-renal, ab-rogar, sob-roda
além, aquém, recém, sem, sota, soto, vice, ex ( = anterioridade)
qualquer palavra
além-mar, aquém-mar, recém-casado, sem-terras, soto-capitão, ex-aluno


a) Fugindo à regra, a palavra extraordinário escreve-se sem hífen.

b) Nos compostos com o prefixo bem, usa-se hífen quando o segundo elemento tem vida autônoma ou quando a pronúncia assim o exigir.

Exemplos: bem-vindo, bem-estar, bem-aventurado, etc.

c) O prefixo sobre apresenta algumas exceções.

Exemplos: sobressair, sobressalto, sobressalente, etc.

d) O prefixo co é seguido de hífen quando tem o sentido de "a par" ou "juntamente" e o segundo elemento tem vida autônoma.

Exemplos: co-aluno, co-autor, co-proprietário.

Existem, no entanto, inúmeras composições consagradas pelo uso em que não se usa o hífen.

Exemplos: coexistir, colateral, correlação, coabitar, coadjuvante, etc.

Autoria: Josiel Alves Moreira


Ao escreve UMA Palavra com som de s, de z, de x ou de j, DEVE-se procurar a Origem dela, pois, na Língua Portuguesa, a palavra primitiva, em muitos casos, indica como deverá escreve a palavra derivada.

1. escreve com -ção as palavras derivadas de vocábulos terminados em -to, -tor, Teve e os substantivos formados Pela posposição do -ção ao tema de Um verbo (Tema é o que sobra, Quand se retira a desinência de infinitivo - R - do verbo).

Portanto DEVE-se procurar a Origem da Palavra terminada em -ção. Por exemplo: Onde provém a palavra conjunção? Resposta: provém de conjunto. Por Issos, escrevemo-la com ç.


* Erudito = erudição
* Exceto = exceção
* Setor = SEÇÃO
* Intuitivo = intuição
* Redator = redação
* Ereto = ereção
* Educar - r + ção = Educação
* Exportar - r + ção = Exportação
* Repartir - r + ção = repartição

2. escreve com -tenção os substantivos correspondentes aos verbos derivados do verbo ter.


* Manter = Manutenção
* Reter = retenção
* Parar = detenção
* Conter = contenção

3. escreve com ara os verbos derivados de substantivos terminados em -ce.


* Alcance = alcançar
* Lance = Láncara


1. escreve com -s- as palavras derivadas de verbos terminados em -nder e -ndir


* Pretender = pretensão
* Defender = defesa, defensivo
* Despender = despesas
* Compreender = compreensão
* Fundir = Fusão
* Expandir = expansão

2. escreve com -s- as palavras derivadas de verbos terminados em -erter, -ertir e -ergir.


* Perverter = perversão
* Converter = conversão
* Reverter = reversão
* Divertir = diversão
* Aspergir = aspersão
* Imergir = imersão

3. escreve -puls- nas palavras derivadas de verbos terminados em -pelir e -curs-, nas palavras derivadas de verbos terminados em -correr.


* Expelir = expulsão
* Impelir = impulso
* Compelir = compulsório
* Concorrer = concurso
* Discorrer = discurso
* Percorrer = percurso

4. escreve com -s- todas as palavras terminadas em -oso e -osa, com exceção de alegria.


* Gostosa
* Glamorosa
* Saboroso
* Horroroso

5. escreve com -s- todas as palavras terminadas em -ase, -esse, -ise e -ose, com exceção de gaze e deslize.


* Fase
* Crase
* Tese
* Osmose

6. escreve com -s- as palavras femininas terminadas em -isa.


* Poetisa
* Profetisa
* Heloísa
* Marisa

7. escreve com -s- toda a conjugação dos verbos por, querer e usar.


* Eu pus
* Ele quis
* Nós usamos
* Eles quiseram
* Quand nós quisermos
* Se eles usassem

C ou S?

Após ditongo, escreve com -ç-, Quand houver som de s, e escreve com -s-, Quand houver som de z.


* Eleição
* Traição
* Neusa
* Coisa

S ou Z?

1.-a) escreve com -s- as palavras terminadas em És e essa que indicarem nacionalidades, títulos ou nomes próprios.


* Português
* Norueguesa
* Marquês
* Duquesa
* Inês
* Teresa

1.-B) escreve com -z- as palavras terminadas em -ez e -eza, substantivos abstratos que provêm de adjetivos, ou sejas, palavras que indicam a existência de umha Qualidade.


* Embriaguez
* Limpeza
* Lucidez
* Nobreza
* Acidez
* Pobreza

2.-a) escreve com -s- os verbos terminados em -isar, Quand a palavra primitiva Já possuir o -s-.


* Análise = analisar
* Busca = pesquisar
* Paralisia = paralisar

2.-B) escreve com -z- os verbos terminados em -izar, Quand a palavra primitiva Não possuir -s-.


* Economia = economizar
* Terror = aterrorizar
* Frágil = fragilizar


* Catequese = catequizar
* Síntese = sintetizar
* Hipnose = hipnotizar
* Batismo = batizar

3.-a) escreve com -s- os diminutivos terminados em -sinho e -sito, Quand a palavra primitiva Já possuir o -s- no final do radical.


* Casinha
* Asinha
* Portuguesinho
* Camponesinha
* Teresinha
* Inesita

3.-B) escreve com -z- os diminutivos terminados em -zinho e -zito, Quand a palavra primitiva Não possuir -s- no final do radical.


* Mulherzinha
* Arvorezinha
* Alemãozinho
* Aviãozinho
* Pincelzinho
* Corzinha


1. escreve com -cess- as palavras derivadas de verbos terminados em -ceder.


* Anteceder = antecessor
* Ultrapassar = excesso
* Conceder = concessão

2. escreve com -press- as palavras derivadas de verbos terminados em -primir.


* Imprimir = impressão
* Comprimir = compressa
* Deprimir = depressivo

3. escreve com -gress- as palavras derivadas de verbos terminados em -gredir.


* Agredir = agressão
* Progredir = progresso
* Transgredir = transgressor

4. escreve com -miss- ou -mess- as palavras derivadas de verbos terminados em -meter.


* Comprometer = compromisso
* Intrometer = intromissão
* Prometer = promessa
* Remeter = remessa

CS ou SS
Em relaçao ao verbos terminados em -tir, teremos:

1. escreve com -ção, ​​se apenas retirarmos a desinência de infinitivo -r, dos verbos terminados em -tir.


* Curtir - r + ção = curtição

2. escreve com -são, Quand, ao retirarmos toda a terminação -tir, a última letra for consoante.


* Divertir - tir + São = diversão

3. escreve com -ssão, Quand, ao retirarmos toda a terminação -tir, a última letra for vogal.


* Discutir - tir & ssão = discussão


1. escreve com -j- as palavras derivadas dos verbos terminados em -jar.


* Trajar = traje, eu trajei.
* Encorajar = que eles encorajem
* Viajar = que eles viajem

3. escreve com -j- as palavras derivadas de vocábulos terminados em -ja.


* Loja = lojista
* Gorja = gorjeta
* Canja = canjica

4. escreve com -j- as palavras de Origem tupi, africana ou popular.


* Jeca
* Jibóia
* Jiló
* Pajé


1. escreve com -g- todas as palavras terminadas em -ágio, -égio, -ígio, -ógio, -úgio.


* Pedágio
* Colégio
* Sacrilégio
* Prestígio
* Relogio
* Refugio

2. escreve com -g- todas as palavras terminadas em -gem, com exceção de pajem, lambujem ea conjugação dos verbos terminados em -jar.


* A Viagem
* A coragem
* A personagem
* A vernissagem
* A ferrugem
* A penugem


1. escreve com -x- as palavras iniciadas por mex-, com exceção de mecha.


* Mexilhão
* Mexer
* Mexerico
* México
* Mexerico
* Mexido

2. escreve com -x- as palavras iniciadas por enx-, com exceção das derivadas de vocábulos iniciados por ch- e da Palavra Enchovas.


* Enxada
* Enxerto
* Enxerido
* Enxurrada


* Cheias = encher, enchente
* Poça = encharcar
* Chiqueiro = enchiqueirar

3. escreve -x- após ditongo, com exceção de recauchutar e guache.


* Ameixa
* Deixar
* Queixa
* Feixe
* Peixe
* Gueixa

UIR e Oer

Os verbos terminados em -uir e -oer terá as 2ª e 3ª Pessoas do singular do presente do indicativo escritas com -i-.


* Sua possue
* Ele possuia
* Tu constróis
* Ele constroi
* Sua Moisés
* Ele mói
* Sua Rois
* Ele rói


Os verbos terminados em -uar e -oar terá todas as Pessoas do presente do subjuntivo escritas com -e-.


* O que eu efetue
* Que tu efetues
* O que ele atenua
* O que nós atenua
* O que você entoeis
* O que eles entoem

Função Quadrática aula 11 Domínio

Gene - funções Código genético e síntese de proteínas

Colégio Estadual Dinah Gonçalves

Os cromossomos são constituídos por um longo filamento de DNA associado a certas proteínas chamadas histonas. Alguns trechos do DNA presente nesses cromossomos dão início a processos de fabricação de proteínas com as mais diversas funções no organismo. Esses trechos de DNA são o que chamamos de genes.

Quanto ao RNA, cujos nucleotídios se agrupam numa cadeia simples, seus diferentes tipos também participam dos processos de síntese proteica, cada um apresentando diferentes funções.

Os genes e o processo da transcrição
O início da síntese de uma proteína se dá quando um determinado trecho de DNA, um gene, tem suas duas cadeias separadas pela ação de uma enzima chamada polimerase do RNA, que também orienta o agrupamento de nucleotídios livres no núcleo, junto a uma dessas cadeias. Esses nucleotídios unem-se, formando, então, uma molécula de RNA.

Os nucleotídios agrupam-se segundo um emparelhamento de bases nitrogenadas parecido com aquele das duas cadeias do DNA, com a diferença de que a adenina se emparelha com a uracila (A - U). Dessa forma, se a sequência de bases nitrogenadas do DNA for, por exemplo, TACAATCGCATTCAGGTACTG, a sequência de bases do RNA formado será AUGUUAGCGUAAGUCCAUGAC.

Esquema do processo de transcrição gênica.

A sequência de bases transcritas a partir do DNA carrega consigo a informação codificada para a construção de uma molécula de proteína. Essa codificação se dá na forma de trincas de bases nitrogenadas, chamadas códons. No nosso exemplo, o RNAm formado possui os seguintes códons: AUG, UUA, GCG, UAA, GUC, CAU, GAC.

As proteínas são moléculas formadas por uma sequência de unidades menores chamadas aminoácidos. Como veremos mais adiante, os códons do RNA formado neste processo determinam os aminoácidos que constituirão uma determinada molécula de proteína. Eles contêm, portanto, uma mensagem para a síntese proteica e, por isso, esse RNA recebeu o nome de "mensageiro".

O processo da tradução gênica
A etapa seguinte da síntese proteica ocorre no citoplasma das células onde o RNAm formado acopla-se a organelas chamadas ribossomos, que são constituídas por RNAr associado a proteínas. É nos ribossomos que ocorre a síntese e eles podem encontrar-se livres no citoplasma ou associados ao retículo endoplasmático rugoso.
Entra em ação, então, o terceiro tipo de RNA, o RNA transportador, que recebe esse nome em virtude de transportar com ele os aminoácidos, as unidades constituintes das proteínas. No RNAt há uma trinca de bases nitrogenadas denominadas anticódon, por meio das quais ele se liga temporariamente ao RNAm no ribossomo pelas bases complementares (códon).

Assim, no caso da sequência do exemplo dado anteriormente (AUGUUAGCGUAAGUCCAUGAC), às três primeiras bases (AUG) vai acoplar-se um RNAt com a sequência UAC; e assim por diante, como no esquema abaixo:

Página 3

A síntese de uma proteína começa com o acoplamento do ribossomo ao RNAm. No ribossomo também se acopla um RNAt, cujo anticódon se liga ao códon do RNAm. Logo em seguida, outro RNAt acopla-se ao segundo códon, ou seja, um ribossomo permite que até dois RNAts se acoplem ao mesmo tempo.

Os aminoácidos transportados em cada RNAt unem-se entre si por meio de uma ligação química conhecida por ligação peptídica. O ribossomo, que catalisa esse processo, desloca-se então sobre o RNAm e o primeiro RNAt se desliga do conjunto ribossomo-RNAm, sendo que os aminoácidos permanecem ligados.

Em seguida, uma nova molécula de RNAt se une ao ribossomo, transportando mais um aminoácido que se junta aos outros dois. O processo continua até que todos os códons do RNAm tenham sido percorridos pelo ribossomo, recebendo os RNAt complementares e formando uma cadeia de aminoácidos, ou seja, uma molécula de proteína.

Esquema do processo de tradução gênica. A estrutura de cor azul claro é o ribossomo.

O código genético
Todas as proteínas presentes nos mais diferentes seres vivos são compostas por combinações entre 20 aminoácidos. Essas combinações são determinadas, como vimos, pelas sequências de códons do RNAm que foram transcritas a partir do DNA. Damos o nome de código genético à correspondência entre os códons e os aminoácidos.

Página 3
Código genético: correspondência entre os códons do RNAm e os aminoácidos trazidos pelo RNAt ao local da síntese protéica.

As quatro bases nitrogenadas do RNAm combinam-se, três a três, formando 64 códons que correspondem a apenas 20 aminoácidos. Dois ou mais códons podem estar relacionados a um aminoácido, assim como alguns não correspondem a aminoácido nenhum. Neste último caso, são códons que determinam o término do processo de tradução.

O código genético é praticamente o mesmo para todos os seres vivos e, por isso, dizemos que ele é universal. Além de universal, ele é considerado "degenerado", pois praticamente todos os aminoácidos são determinados por mais de um códon.

Mas qual a relação de tudo o que vimos com as características de um indivíduo? As proteínas têm importantes funções no nosso corpo: são substâncias essenciais para a construção das células dos seres vivos e atuam como enzimas, controlando praticamente todo o metabolismo celular. Portanto, os genes (as porções de DNA que transcrevem RNAm), sendo os responsáveis pelo controle da produção de proteínas, controlam também todas as características dos indivíduos.
Maria Graciete Carramate Lopes

Intervalos Numéricos Aula 1


A adenohipófise ou lobo anterior da hipófise é uma glândula que produz diversos hormônios e, entre eles, a prolactina (LTH ou PRL). Esta última atua sobre os ovários, secretando a progesterona, e estimula a produção de leite. Atuando em sinergismo com a progesterona e o estrógeno, promove o crescimento e funcionamento das glândulas mamárias. A prolactina é produzida, principalmente, durante a gravidez e durante a amamentação.

Nos homens, pouco se sabe a respeito da atuação deste hormônio, contudo, é de conhecimento que altas concentrações prejudicam a produção de testosterona e causam um aumento do volume das mamas. Nas mulheres, a prolactina em níveis mais altos pode causar alterações menstruais, alterações nos caracteres sexuais secundários e até infertilidade.

O stress pode influenciar o aumento dos níveis de prolactina, reduzindo a produção de progesterona. Assim, percebe-se que uma tem efeito regulador sobre a outra.

Hipotireoidismo, anticoncepcionais, determinados antipsicóicos, antidepressivos, tranqüilizantes e bloqueadores de histamina, exercícios físicos intensos e câncer na tireóide podem aumentar os níveis deste hormônio. Além de tais fatores, causas fisiológicas, como: gravidez, amamentação, período neonatal, sono, exercícios e causas patológicas, como: patologias no hipotálamo, insuficiência renal, hipotireoidismo e ovários policísticos alteram estes valores.

A liberação reduzida de prolactina sugere alguma doença que causa destruição da hipófise.
extraido de

Eletromagnetismo (1) Ímãs e indução eletromagnética

Colégio Estadual Dinah Gonçalves

Conta uma lenda que a palavra magnetismo deriva do nome de um pastor da Grécia antiga, chamado Magnes, que teria descoberto que um determinado tipo de pedra atraía a ponta metálica de seu cajado. Em homenagem a Magnes, a pedra foi chamada de magnetita, de onde derivam as palavras magnético e magnetismo.

Uma outra versão atribui o nome do mineral ao fato de ele ser abundante na região asiática da Magnésia. Seja qual for a versão verdadeira da origem da palavra, a magnetita é um imã natural - um minério com propriedades magnéticas.

Sejam naturais ou artificiais, os ímãs são materiais capazes de se atraírem ou repelirem entre, si bem como de atrair ferro e outros metais magnéticos, como o níquel e o cobalto.

Os imãs possuem dois pólos magnéticos, chamados de pólo norte e pólo sul, em torno dos quais existe um campo magnético. Seguindo a regra da atração entre opostos, comum na física, o pólo norte e o sul de dois imãs se atraem mutuamente. Por outro lado, se aproximarmos os pólos iguais de dois imãs o efeito será a repulsão.

O campo magnético é um conjunto de linhas de força orientadas que partem do pólo norte para o pólo sul dos imãs, promovendo sua capacidade de atração e repulsão, mecanismo que fica explicado na figura que segue:

As linhas de força promovem a atração entre pólos opostos e repulsão entre pólos iguais.

Um fato interessante sobre os pólos de um imã é que impossível separá-los. Se cortarmos um imã ao meio, exatamente sobre a linha neutra que divide os dois pólos, cada uma das metades formará um novo imã completo, com seu próprio pólo norte e sul.

Perfis magnéticos
Um modo de visualizarmos as linhas de força do campo magnético é pulverizando limalha de ferro em torno de um imã. Abaixo, a figura ilustra esse efeito pelo qual as partículas metálicas atraídas desenham o perfil do campo magnético.


Limalha de ferro desenha as linhas de força do campo magnético de um imã.

Como os planetas também possuem pólos magnéticos norte e sul, a Terra se comporta como um imenso imã, razão pela qual, numa bússola, o pólo sul da agulha imantada aponta sempre para o pólo norte da Terra.

Entretanto, se as propriedades dos imãs já eram conhecidas desde a antiguidade, demorou um bom tempo até que as correlações entre os fenômenos elétricos e magnéticos fossem estabelecidos. O cientista inglês Michael Faraday (1791-1867) foi um dos pioneiros do estudo desta correlação.

Indução eletromagnética
Faraday descobriu que uma corrente elétrica era gerada ao posicionar um imã no interior de uma bobina de fio condutor. Deduziu que se movesse a bobina em relação ao imã obteria uma corrente elétrica contínua, efeito que após comprovado recebeu o nome de indução eletromagnética.

A indução eletromagnética é o princípio básico de funcionamento dos geradores e motores elétricos, sendo estes dois equipamentos iguais na sua concepção e diferentes apenas na sua utilização.

No gerador elétrico, a movimentação de uma bobina em relação a um imã produz uma corrente elétrica, enquanto no motor elétrico uma corrente elétrica produz a movimentação de uma bobina em relação ao imã.

A seguir, a ilustração representa o efeito de indução eletromagnética, como pesquisado por Faraday:

A movimentação de um campo elétrico próximo a uma bobina produz a corrente elétrica i.

O princípio da indução eletromagnética é também a base de funcionamento dos eletroímãs, equipamentos que geram campos magnéticos apenas, enquanto uma corrente elétrica produz o efeito de indução. Uma vez desligados perdem suas propriedades, ao contrário dos imãs permanentes.

Hoje, as leis do eletromagnetismo fundamentam boa parte da nossa tecnologia mecânica e eletroeletrônica. Os campos magnéticos e suas interações elétricas fazem funcionar desde um secador de cabelos até os complexos sistemas de telecomunicações, desde os poderosos geradores elétricos das usinas nucleares até os minúsculos componentes utilizados nos circuitos eletrônicos. Magnes, o lendário pastor grego, ficaria muito impressionado com o que se descobriu fazer possível com os poderes da pedra que encontrou por acaso.
* Carlos Roberto de Lana é professor e engenheiro químico.


Fundamentais para a manutenção dos processos biológicos vitais, as vitaminas só começaram a ser estudadas no início do século XX. Já bem antes, porém, sabia-se ser necessário incluir certos alimentos na dieta, para evitar algumas doenças.

Vitamina é um composto orgânico biologicamente ativo, necessário ao organismo em quantidades muito reduzidas para manter os processos vitais. Como as enzimas, representa um autêntico biocatalizador, que intervém em funções básicas dos seres vivos, como o metabolismo, o equilíbrio mineral do organismo e a conservação de certas estruturas e tecidos.

Características gerais

Nos séculos XVIII e XIX, várias observações empíricas demonstraram que existiam nos alimentos algumas substâncias que evitavam doenças como o beribéri e o escorbuto. Até o início do século XX, no entanto, não se comprovara a importância efetiva de tais compostos, a que em 1912 o químico polonês Casimir Funk chamou vitaminas. As vitaminas diferem entre si consideravelmente quanto a estrutura, propriedades químicas e biológicas e atuação no organismo.

A carência de vitaminas na dieta produz doenças graves, as avitaminoses, como o raquitismo, a nictalopia (cegueira noturna), a pelagra, diversas alterações no processo de coagulação do sangue e a esterilidade. Também a ingestão excessiva de vitaminas pode causar perturbações orgânicas, as hipervitaminoses.

As necessidades vitamínicas de um indivíduo variam de acordo com fatores como idade, clima, atividade que desenvolve e estresse a que é submetido. A quantidade de vitaminas presente nos alimentos também não é constante. Varia de acordo com a estação do ano em que a planta foi cultivada, o tipo de solo ou a forma de cozimento do alimento (a maior parte das vitaminas se altera quando submetida ao calor, à luz, ao passar pela água ou quando na presença de certas substâncias conservantes ou saporíferas).

As vitaminas receberam nomes científicos, mas são vulgarmente conhecidas por letras maiúsculas ou por um termo associado à doença produzida pela carência da vitamina no organismo. A vitamina A ou retinol, por exemplo, é chamada também antixeroftálmica. A classificação geral das vitaminas é feita de acordo com sua solubilidade em água ou gordura. As vitaminas hidrossolúveis são as que compõem o complexo vitamínico B (B1, B2, B6 e B12) e a vitamina C. As lipossolúveis compreendem as vitaminas A, D, E e K.

Vitaminas hidrossolúveis

As vitaminas solúveis em água são absorvidas pelo intestino e transportadas pelo sistema circulatório até os tecidos em que serão utilizadas. O grau de solubilidade varia de acordo com cada vitamina e influi no caminho que essa substância percorre no organismo. Quando ingeridas em excesso, as vitaminas hidrossolúveis são armazenadas até uma quantidade limitada nos tecidos orgânicos, mas a maior parte é secretada na urina.

A tiamina ou vitamina B1 é importante no metabolismo de alguns ácidos orgânicos. Sua carência provoca uma doença nervosa caracterizada por paralisia e insensibilidade, o beribéri. A B1 é encontrada em diversos alimentos, principalmente na casca do arroz. A vitamina B2, ou riboflavina, cumpre importante papel na chamada cadeia transportadora de elétrons, processo básico na respiração celular e na obtenção de energia por parte da célula. É abundante na levedura, nos ovos e no leite. Sua deficiência produz distúrbios visuais, fissuras nos lábios e inflamação da língua. A vitamina B6 intervêm no metabolismo dos aminoácidos e sua deficiência provoca insônia, irritabilidade, fraqueza, dor abdominal, dificuldade de andar e convulsões. São ricos em vitamina B6 (pirodoxina, piridoxamina e piridoxal) alimentos como cereais integrais, legumes e leite.

A cobalamina (vitamina B12), presente principalmente na carne de fígado, está associada à maturação dos glóbulos vermelhos no sangue. A carência dessa vitamina se traduz em anemia pronunciada, a chamada anemia perniciosa. A vitamina PP, também chamada niacina ou ácido nicotínico, também é um dos elementos do complexo B. Sua carência causa a pelagra, doença que se caracteriza por erupções na pele, além de distúrbios neurológicos e gastrintestinais.

A vitamina C ou ácido ascórbico é abundante nas frutas cítricas e vegetais verdes. Suas funções no organismo são múltiplas: participa da síntese do colágeno (proteína importante na formação da pele saudável, tendões, ossos e tecidos de sustentação e na cicatrização de feridas); da manutenção das paredes dos vasos sangüíneos; do metabolismo de alguns aminoácidos; e da síntese ou liberação de hormônios da glândula supra-renal. Sua deficiência produz o escorbuto, doença caracterizada por lesões nas gengivas, queda de dentes e hemorragias por todo o corpo, que podem levar à morte. A hipótese de que a vitamina C ajuda a prevenir ou mesmo curar certas doenças (como o resfriado comum ou algumas doenças malignas e infecciosas) continua a ser pesquisada, mas sem nenhum dado científico que a comprove.

Vitaminas lipossolúveis

As vitaminas solúveis em gorduras são absorvidas no intestino humano com a ajuda de sais biliares segregados pelo fígado. O sistema linfático as transporta a diferentes partes do organismo. O corpo pode armazenar uma quantidade maior de vitaminas lipossolúveis do que de hidrossolúveis. As vitaminas A e D são armazenadas sobretudo no fígado e a E nos tecidos gordurosos e, em menor escala, nos órgãos reprodutores. O organismo consegue armazenar pouca quantidade de vitamina K. Ingeridas em excesso, algumas vitaminas hidrossolúveis podem alcançar níveis tóxicos no interior do organismo.

A vitamina A é encontrada na gema do ovo, na manteiga e nas carnes de fígado e de peixes. Não está presente nas plantas, mas muitas verduras e frutas contêm alguns tipos de pigmentos (como o betacaroteno), que o organismo pode converter em vitamina A. A cenoura, por exemplo, é excelente fonte de betacaroteno. A vitamina A é fundamental para a visão e sua carência produz, entre outras doenças, o ressecamento da córnea e da conjuntiva do olho (xeroftalmia) e a ceratomalácia (amolecimento da córnea, com infiltração e ulceração), além de sérios problemas gastrintestinais.

A hipervitaminose A é caracterizada por diversos sintomas, como náusea, alterações do cabelo (que ficam ásperos e caem facilmente), ressecamento e escamação da pele, dor nos ossos, fadiga e sonolência. Também são comuns problemas de visão, dores de cabeça, distúrbios de crescimento e aumento do fígado.
A vitamina D pode ser obtida do óleo de fígado de bacalhau e também pela ação da luz ultravioleta sobre alguns esteróis. Os mais importantes desses esteróis são o 7-diidrocolesterol, formado por processos metabólicos animais, e o ergosterol (presente em óleos vegetais). A ação da luz solar converte essas duas substâncias em colecalciferol (vitamina D3) e ergocalciferol (vitamina D2), respectivamente. As duas participam dos processos de absorção do cálcio na corrente sangüínea e de formação dos ossos. Sua carência causa o raquitismo, em crianças, e a osteomalácia, em adultos, principalmente mulheres. A hipervitaminose D pode provocar fraqueza, fadiga, perda de apetite, náusea e vômitos.

Chamada também tocoferol, a vitamina E ocorre no gérmen de trigo, na gema de ovo, em verduras e legumes. Atua no organismo como um inibidor dos processos de oxidação em tecidos orgânicos. Protege as gorduras insaturadas da oxidação por peróxidos ou outros radicais livres.

A vitamina K é a naftoquinona encontrada nas folhas das plantas. Suas fontes mais abundantes são o óleo de soja, o espinafre e a couve. É necessária na síntese orgânica de quatro fatores de coagulação do sangue: protrombina e fatores VII, IX e X. A deficiência de vitamina K no organismo prolonga o tempo de coagulação do sangue e pode causar hemorragias internas.

*Vitamina A: Substância orgânica, álcool solúvel em gordura. Tem papel fundamental no mecanismo da visão, intervém no metabolismo dos lipídios e protídios e nas funções da tireóide e dos ovários. Encontrada no fígado de animais, na manteiga e nos ovos. Também chamada retinol.

*Vitamina B: Designação genérica de um complexo de substâncias orgânicas hidrossolúveis, que inclui as vitaminas B1, B2, B6 e B12.

Vitamina B1: Substância orgânica solúvel em água. Regulariza o metabolismo glicídico. Sua deficiência provoca o beribéri e pode também causar afecções dos aparelhos digestivo e respiratório. Encontrada em sementes, cascas de cereais e carne de porco. Também chamada tiamina.

Vitamina B2: Substância orgânica solúvel em água. Funciona como fator complementar de várias enzimas. Sua carência no organismo provoca perturbações oculares, lesões nas mucosas e na pele. Encontrada no leite, ovos e fígado. Também chamada riboflavina.

Vitamina B3: Esta vitamina administra-se igualmente quando existem perturbações digestivas do tipo glossite ou estomatite, nas colites e enterocolites assim como em casos de diarreia profusa, espru tropical ou esteatorreia idiopática, regra geral, associada a outras vitaminas do complexo B.

Vitamina B5: Para o restabelecimento de uma nutrição e volume sanguíneo corretos após uma intervenção cirúrgica, continua a ser necessário existir um agente como o ácido pantoténico que encurte o período de atonia intestinal pós-operatória.

No uso externo, é igualmente utilizada no caso de perturbações da nutrição das unhas, cãibras da gravidez, vermelhidão nas nádegas dos lactantes, seborreia, queda do cabelo e calvície, sendo frequentemente administrada em associação com a vitamina B 2 ,com efeito anti-seborreico, sob a forma de injecções ou de comprimidos, ou então localmente sob a forma de fricções. Esta vitamina pode ser igualmente administrada como aerossol no caso de determinadas afecções respiratórias crónicas (rinite, rinofaringite, sinusite). É também útil nas afecções estomatológicas. Adicionalmente, o seu uso é recomendado na luta contra a acção tóxica de determinados antibióticos.

Aparentemente, os ácidos salicílico, mandélico e omega-metil-pantoténico têm uma acção anti-vitamina B 5 . Não se pode, pois, tomar aspirina ou derivados (salicilatos) quando se segue um tratamento com vitamina B 5 .

Vitamina B6: Complexo de substâncias orgânicas solúveis em água. Necessária para o crescimento e as funções musculares e nervosas. Encontra-se no germe de trigo, levedura de cerveja, cereais, fígado, músculos e leite. Também chamada piridoxina.

Vitamina B8: A biotina desempenha, indubitavelmente, um papel fundamental na manutenção da integridade da pele. Na medida em que se tratam de formas localizadas ou generalizadas, como o síndroma de Leiner-Mossus, as dermatites seborreicas e, em especial, a dermatite seborreica do lactante, constituem a indicação habitual da biotina.

Atualmente, tende-se cada vez mais a propor o emprego da biotina no adulto para o tratamento da acne e de todas as alopecias, com ou sem seborreia. Obtiveram-se resultados particularmente interessantes com a associação da biotina ao ácido pantoténico por via sistémica.

Vitamina B12: Complexo de substâncias orgânicas solúveis em água. Exerce ação anabolizante e sua deficiência conduz à anemia macrocítica. Encontrada nos ovos, na carne e nos laticínios. Também chamada cobalamina.

A deficiência de vitamina B 12 é a causa da anemia perniciosa. Pode surgir devido a um aporte insuficiente na alimentação ou devido à ausência do factor intrínseco, indispensável para a absorção de vitamina B 12 . A alteração da absorção deste tipo de vitamina pode ser uma sequela de intervenções cirúrgicas ao estômago ou, por outro lado, da prática de um Billroth II, dado que um terço dos doentes podem deixar de produzir para sempre o factor intrínseco. Esta deficiência pode conduzir, igualmente, a uma diverticulose intestinal e a uma infecção pelo parasita intestinal Diphyllobothrium latum.

Normalmente, esta vitamina é receitada em associação com outras vitaminas B: com a B 1 e a B 6 em casos de afecções neurológicas ou reumáticas, neurites e polineurites, enxaquecas, nevralgias cervicobraquiais, torcicolos e lumbago, quando a vitamina B 12 é administrada sobretudo, pelas suas propriedades tróficas e antiálgicas.

*Vitamina C: Substância orgânica solúvel em água. Importante para a síntese do colágeno, a manutenção da estrutura dos vasos sangüíneos e a liberação de hormônios. Sua carência conduz ao escorbuto. Encontrada em frutas cítricas e vegetais verdes. Também chamada ácido ascórbico.

*Vitamina D: Substância orgânica solúvel em gordura. Formada por irradiação pela luz ultravioleta de alimentos que contêm ergosterol. Essencial ao metabolismo do cálcio dos ossos. Sua carência conduz ao raquitismo. Encontrada no arenque, na sardinha, na cebola e na gema de ovo. Também chamada calciferol.

Vitamina E: Grupo de compostos orgânicos solúveis em gordura. Atua como inibidor dos processos de oxidação do organismo. Sua deficiência, rara nos homens e freqüente em animais, causa distrofias musculares. Encontrada em azeites vegetais e folhas de vegetais verdes. Também chamada tocoferol.

*Vitamina K: Grupo de substâncias orgânicas solúveis em gordura. Necessárias à síntese de fatores de coagulação do sangue. Presentes nas folhas das plantas, suas fontes mais abundantes são o óleo de soja, o espinafre e a couve. Sua deficiência no organismo prolonga o tempo de coagulação do sangue e pode causar hemorragias. Também chamada naftoquinona.

Niacina: Vitamina do grupo do complexo B, formada no organismo a partir do aminoácido triptofânio. Sua carência provoca pelagra, dermatite, demência e diarréia. Também chamada ácido nicotínico ou fator PP.

Autoria: Fabrícia Carvalho

Tecido Nervoso

► Tecido Nervoso

Tem como função de captar estímulos ambientais ou do próprio corpo, conduzir impulsos nervosos e interpretá-los, na coordenação das funções dos órgãos.

O tecido nervoso forma os órgãos dos sistemas nervosos central, periférico e autônomo. Ele tem por função coordenar as atividades de diversos órgãos, receber informações do meio externo e responder aos estímulos recebidos. É constituído por células nervosas ou neurônios e células de apoio ou células da glia. As células nervosas ou neurônios que é uma célula altamente diferenciada, de ciclo vital longo, sem capacidade de divisão e de regeneração, têm prolongamentos ramificados, os dendritos, e um cilindro - eixo, o axônio, geralmente mais longos que os dendritos. Muitas vezes o axônio é protegido por um envoltório denominado bainha de mielina.

Os neurônios tem uma forma especial de reação, que consiste no impulso nervoso, produzido sempre na mesma direção: dos dentritos são prolongados e partem do corpo celular, recolhem impulsos nervosos e deste para o axônio. Os neurônios relacionam-se uns com os outros pelas extremidades de suas ramificações, que não se tocam mas ficam bem próximas. Essas áreas de conexão são denominadas sinapses. É através das sinapses que o impulso passa do axônio de uma célula para os dentritos de outra. Feixes de axônios revestidos por tecido conjuntivo formam os nervos. Conforme os axônios apresentam ou não a bainha de mielina, os nervos são classificados em mielínicos ( nervos brancos) e a amielínicos (nervos cinzentos).

Encaixadas entre os neurônios, com função de apoio e preenchimento, encontram-se células especiais que constituem a neuróglia.


Neurônios ou células nervosas, têm a propriedade de receber e transmitir estímulos, permitindo ao organismo responder a alterações do meio. São células grandes que apresentam um corpo celular ou pericário, de onde partem dois tipos de prolongamentos: os axônios e os dendritos.

- Dendritos: são prolongamentos citoplasmáticos que podem ou não ser pequenos, apresentando grande numero de ramificações. São estruturas especializadas na função de receber estímulos.

- Axônio: é uma única expansão citoplasmática, longa e de diâmetro constante, cuja porção final apresenta ramificações. Estrutura especializada na transmissão do impulso nervoso.


Chamada também de glia, e outro tipo de célula que constitui o tecido nervoso.

São menores do que os neurônios e se relacionam com a sustentação é nutrição dos neurônios, com a sustentação e nutrição dos neurônios, com a produção de mielina e a fagocitose.

Fibras nervosas

Todos os axônios das células nervosas apresentam-se envoltos por bainha, sendo a conjunto axônio e bainha, sendo o conjunto axônio e bainha envoltória denominada fibra nervosa.

Transmissão do impulso nervoso

O impulso nervoso é causado por um estimulo do neurônio, provocando modificações elétricas é químicas que são transmitidas ao longo dos neurônios sempre no sentido dendrito-axônio. A membrana do axônio em repouso apresenta carga elétrica positiva do lado interno. Os neurônios conectam-se entre si e aos órgãos através de um tipo especial de junção, denominada sinapse. O impulso nervoso proporciona, na região das sinapses, liberação de vesículas contendo mediadores químicos, que podem ser acetilcolina ou adrenalina.

Esses mediadores químicos caem na fenda sináptica, excitando a membrana do dentrito e dando origem à atividade elétrica ou outro neurônio.

Os mediadores químicos que caem na fenda sináptica são degradados, logo em seguida, por ensinas especificas.

Transmissão de impulsos nervosos:

Sentido do impulso nervoso entre neurônios: dendrito ⇒ axônio

Sinapse: região de encontro entre neurônios e entre neurônios e órgãos, onde ocorre a transmissão química de impulsos elétricos.

Mediadores químicos na sinapse: acetilcolina ou adrenalina.

Autoria: Sidney Magalhães

Conceito de aceleração

Quando observamos um determinado automóvel se deslocando percebemos que ele muda de velocidade com o passar do tempo. Quando a sua velocidade é crescente dizemos que o movimento é uniformemente acelerado, e se diminui sua velocidade dizemos que ele está em movimento uniformemente retardado. Mas o que vem a ser aceleração?

Em Física, aceleração é a taxa de variação da velocidade em relação ao tempo, ou seja, é a rapidez com que a velocidade de um corpo varia. É uma grandeza vetorial que como tal possui módulo, direção e sentido. No Sistema Internacional de Unidades (SI) a unidade de aceleração é o metro por segundo ao quadrado (m/s2).

No movimento retilíneo uniforme (MRU) a velocidade é sempre constante, sendo assim, esse tipo de movimento não possui aceleração, ou melhor, sua aceleração é nula (a = 0). Porém, no movimento retilíneo uniformemente variado (MRUV), como o próprio nome diz, a velocidade varia de forma uniforme em todos os instantes do movimento. Assim, a aceleração do movimento é constante e pode ser determinada da seguinte forma:


am é a aceleração média;
ΔV é a variação de velocidade: ΔV= V2 – V1
Δt é o intervalo de tempo que ocorre a variação da velocidade: Δt = t2 – t1.

Tecido Muscular

Cola da Web » Biologia » Histologia » Tecido Muscular

► Tecido Muscular

O tecido muscular é constituído por células alongadas, em forma de fibras, que se dispõe agrupadas, em forma de fibras, que se dispõe agrupadas em feixes. Essas células são capazes de se contrair e conferem ao tecido muscular a capacidade de movimentar o corpo.

Há três variedades de tecido muscular: liso, estriado e cardíaco.

O tecido muscular liso tem células mononucleadas, alongadas, de extremidades afiladas. O citoplasma apresenta miofibrilas (Miofibrila: mio, músculo, fibrila, pequena fibra),dispostas longitudinalmente, formadas por proteínas contráteis. É o tecido que forma as paredes de vários órgãos, com intestino, vasos sangüíneos, bexiga etc.

O tecido muscular estriado é capaz de contrações rápidas, sob o controle da vontade, denominado esquelético, por se prender aos ossos. Suas células são alongadas cilíndricas e multinucleadas. Apresentam estrias transversais típicas, formadas pela disposição paralela e regular das miofibrilas no citoplasma. Essas miofibrilas são constituídas por duas proteínas contráteis: a actina forma filamentos finos e a miosina filamentos mais grossos.

O tecido muscular cardíaco é um tecido estriado especial, cujas células apresentam estrias como as do tecido esquelético, mas têm apenas um ou dois núcleos e são mais curtas. Além disso, as fibras se fundem umas com as outras pelas extremidades.

Os microtúbulos

Os microtúbulos

Os microtúbulos são sintetizados através da polimerização da molécula de tubulina. Sempre que é necessária a sua presença

Os microtúbulos são filamentos que se formam em cilindros compridos e frágeis com aproximadamente 25 nm de diâmetro.
Composição Química
Os microtúbulos são constituídos por uma proteína denominada tubulina.


Os microtúbulos aparecem no citoplasma de todas as células eucariontes.


Dentre as funções dos microtúbulos, as principais são a movimentação e estrutura de cílios e flagelos, e o transporte intracelular.

O que é Tecido ?

► O que é Tecido?

"Tecido é uma especialização morfológica, físico-químico e fisiológica de células" (GRASSE).

"Tecido é um conjunto de células da mesma natureza, diferenciadas em determinado sentido para poderem realizar a sua função própria" (SCHUMACHER).

"Tecido é um grupo de células que apresentam a mesma função própria" (MENEGOTTO). Todos estão corretos. Os tecidos do corpo dos animais vertebrados desempenham variadas funções que por sua vez são formados por células especializadas. No corpo dos animais pluricelulares, exceto espongiários, e constituído por células agrupadas e organizadas, formando os tecidos.

Precisa-se de requisito para termos um tecido que seja composto de um grupo de células, que devera apresentar a mesma função.

Os tecidos fundamentais nos animais são estes: Epitelial, Muscular, Nervoso, Sanguíneo e conjuntivo. Nos invertebrados estes tipos de tecido são basicamente os mesmos, porem com organizações mais simples. A maioria dos tecidos além de serem compostos de células, apresentam entre elas substâncias intracelulares(intersticiais).

Autoria: Renan Roberto Bardine

Calculando a Diagonal do Quadrado e do Retângulo

Calculando a Diagonal do Quadrado e do Retângulo

Marcos Noé

Quadrados e retângulos
Os estudos relacionados à criação da Geometria e da Trigonometria datam dos séculos anteriores ao nascimento de Cristo. Naquela época, os grandes pensadores buscavam formas de elucidar situações matemáticas envolvendo a Geometria. Dentre esses inúmeros estudos surgiu um dos mais conhecidos e aplicáveis fundamentos da Matemática, o Teorema de Pitágoras.

Os primeiros passos rumo à criação do Teorema de Pitágoras ocorreram baseados no estudo do triângulo retângulo, em que Pitágoras estabeleceu uma relação entre os lados dessa figura de formato triangular. Os lados perpendiculares, isto é, que formam o ângulo de 90º (reto) foram denominados de catetos e o lado oposto ao ângulo reto foi chamado de hipotenusa.
A relação proposta por Pitágoras sugere que: “A soma dos quadrados dos catetos é igual ao quadrado da hipotenusa.”

Essa relação utilizada para o cálculo das medidas de um dos lados do triângulo retângulo, também é utilizada para o cálculo das medidas de um quadrado ou retângulo. Nesses quadriláteros temos um elemento denominado diagonal, caracterizado por um segmento de reta responsável por unir dois vértices da figura. Observe os quadriláteros a seguir com destaque em relação a uma de suas diagonais.

Observe que ao traçarmos uma das diagonais dividimos o quadrilátero em dois triângulos retângulos, nos quais podemos aplicar o Teorema de Pitágoras para o cálculo das medidas desconhecidas.

Exemplo 1

Determine a medida da diagonal do seguinte quadrilátero.

A diagonal possui medida igual a 6√2 metros.

Exemplo 2

Uma casa possui a forma de um retângulo com medidas iguais a 14 metros de comprimento e 10 metros de largura. Determine a medida da diagonal dessa casa.
Diagonal medindo 2√74 metros.

Exemplo 3

Determine a medida do comprimento de uma região retangular com diagonal e largura medindo 50 e 30 metros, respectivamente.
O comprimento possui medida equivalente a 40 metros.

Estudo das Cônicas Parábola aula 5

Teorema de Tales

Função Quadrática aula 6 máximo e mínimo


Frações de frações

Definição: Fração de fração é uma ou mais partes de uma fração

Regra - Para se calcular uma fração, basta fazer a multiplicação das frações.

Redução de fração

Reduzir inteiros a fração imprópria

Regra – Para se reduzir um número inteiro a fração imprópria de denominador conhecido, multiplica-se o número inteiro pelo denominador e escreve-se a fração cujo numerador é o produto obtido e o denominador é o denominador dado.
Seja reduzir 8 inteiros a quartos.
Um inteiro vale 4 quartos: 8 inteiros valerão 8 vezes 4 quartos ou 32/4.

Reduzir um número misto a fração imprópria

Regra – Para se reduzir um número misto a fração imprópria, multiplica-se o número inteiro pelo denominados da fração, e junta-se ao produto o numerador da fração. A soma é o numerador da fração imprópria equivalente procurada; o denominador é o do número misto.
Vamos reduzir o número misto 54/7 a fração imprópria.
Segundo a regra temos o resultado 39/7.

Extrair inteiros de uma fração imprópria

Regra – Para se extrair os inteiros de uma fração imprópria, divide-se o numerador pelo denominador; o quociente dá os inteiros. O resto, se houver, é o numerador de uma fração que tem, como denominador, o denominador da fração imprópria.

Vamos extrair os inteiros da fração imprópria 26/9.

Efetuando-se a divisão, obtém-se o quociente 2 e o resto 8, que é o numerador de uma fração cujo denominador é 9.

A fração imprópria 26/9 contém, pois, 2 inteiros e 8/9.

Simplificar frações

- Simplificar uma fração é representá-la por termos menores, sem lhe alterar o valor.

Simplificam-se as frações para se reconhecer mais facilmente o seu valo e facilitar os cálculos.

A simplificação de frações baseia-se no princípio já visto: Pode-se dividir os dois termos de uma fração por um mesmo número sem lhe alterar o valor.

Reduzir uma fração à mais simples expressão

- Reduzir uma fração à mais simples expressão, é representá-la pelos menores números possíveis.

Obtém-se este resultado, dividindo-se sucessivamente os dois termos da fração por todos por divisores que lhes são comuns:

Na fração 900/1 260.

Os dois termos terminados por zero podem ser divididos por 10, e a fração torna-se 90/126.
Os dois termos desta nova fração são depois divididos por 9. Efetuando-se a operação, obtém-se 10/14, cujos termos, 5 e 7. São primos entre si.

A mais simples expressão da fração 900/1260 é a fração 5/7.

Abrevia-se consideravelmente os cálculos da simplificação, dividindo-se logo os dois termos por seu máximo divisor comum.

Assim o m.d.c. dos dois termos da fração 900/1260 é 180; temos assim a mais simples desta fração:

900/180 = 5
1260/180 = 7

Simplificar frações impróprias ou expressões fracionárias

– Pode-se começar por extrair os inteiros da fração imprópria e, em seguida, pelos processos ordinários, simplificar a nova fração, se existir.

Vamos simplificar a fração imprópria 84/15.

Extraindo os inteiros, temos: 5 inteiros e 9/15. Simplificando 9/15, temos para resultado final: 5 inteiros e 3/5.
Adição e subtração com denominadores diferentes

Neste caso efetua-se a substituição das frações dadas por outra equivalentes, fazendo uso do cálculo do MMC dos denominadores.

1/4 + 1/2 + 2/3

MMC (4,2,3) = 12


3/12 + 6/12 + 8/12


* Exercícios resolvidos para prática

1. Calcule os resultados das expressões

a) 8 1 + 3 2 (Frações com números mistos)

2 5


(8 + ½) + (3 + 2/5) =

(8 + 3) + (1/2 + 2/5) =

11 + (1/2 + 2/5) = 11 + (5/10 + 4/10) =

11 9/10

b) 15 5/6 – 2 3/4


(15 + 5/6) – (2 + ¾) =

(15 – 2 ) + (5/6 – ¾) =

13 (10/12 – 9/12) =

13 1/12

c) 2 1/3 x 4/5


(2 + 1/3) x 4/5 =

2 x 3 + 1_ x 4/5 =


7/3 x 4/5 =

28/15 = 1+13/15

d) 1/2 ÷ (1 3/4)

1/2 ÷ (1 + 3/4) =

1/2 ÷ 1 x 4 + 3 = 1/2 ÷ 7/4 =


1/2 x 4/7 = 4/14 (fazendo a simplificação pelo número 2)


* Multiplicação de frações

Os passos para se efetuar uma multiplicação de frações são simples:

1) Multiplicar o numerador, dando origem a outro númerador

2) Multiplicar o denominador, dando origem a outro denominador


a) 2/5 x 3/2 =


b) 4/3 x 1/5 x 1/4 =

4/60 (Neste caso podemos simplificar por 4)


* Divisão de frações

Para dividir uma fração deve-se multiplicar o primeiro número pelo inverso do segundo número da equação dada, ou seja, o dividendo pelo inverso do divisor.


a) 3/5 ÷ 2/7 =

3/5 x 7/2 =


b) 2/3 ÷ 1/6

2/3 x 6/1 =

12/3 (Neste caso podemos simplificar)



Nunca faça contas envolvendo dízimas periódicas (ensinado no tutorial anterior). Faça a troca de todas as dízimas periódicas por frações geratrizes (também comentado no tutorial anterior) antes de efetuar qualquer conta.

* Exercícios resolvidos para prática

a) Quanto vale 3/4 de 480 ?


3/4 x 480 =

3 x 480 = 1440/4 = 360


Então, dois terços de 480 são 360.

b) João gastou em compras diversas dois quintos da quantia que possuía e ainda lhe resta o valor de R$ 80,00. Quanto João tinha inicialmente?


Neste o problema menciona quintos de uma quantia. Assim é possível indicar por 5x.

Inicial = 5x

Gastos = 3/5 de 5x = 3x

Resto = 80,00

Temos então:

5x – 3x = 80

2x = 80

X = 80/2

X = 40

Logo, como a quantia inicial foi representada por 5x, temos então:

5x = 5 x 40 = 200,00

João tinha inicialmente um valor de R$ 200,00

c) Um caderno de 10 matérias custa 2/3 a mais que um caderno de 5 matérias. Juntos eles tem o valor de R$ 24,00. Qual o valor de cada caderno?


O preço do caderno 10 matérias foi indicado como 2/3 a mais do preço do outro caderno, temos:

Caderno 5 matérias: 3x

Caderno 10 matérias : 3x + 2/3 de 3x = 3x + 2x = 5x

Juntos os cadernos tem o valor de R$ 24,00

3x + 5x = 24,00

8x = 24

x = 3


O caderno de 5 matérias custa : 3x = 3 x 3 = R$ 9,00

O caderno de 10 matérias custa : 5x = 5 x 3 = R$ 15,00


Colégio Estadual Dinah Gonçalves


É a relação que se estabelece entre duas palavras ou mais que apresentam significados iguais ou semelhantes - SINÔNIMOS.

Ex.: Cômico - engraçado
Débil - fraco, frágil
Distante - afastado, remoto


É a relação que se estabelece entre duas palavras ou mais que apresentam significados diferentes, contrários - ANTÔNIMOS.

Ex.: Economizar - gastar
Bem - mal
Bom - ruim


É a relação entre duas ou mais palavras que, apesar de possuírem significados diferentes, possuem a mesma estrutura fonológica - HOMÔNIMOS.

As homônimas podem ser:


Homógrafas heterofônicas ( ou homógrafas) - são as palavras iguais na escrita e diferentes na pronúncia.
Ex.: gosto ( substantivo) - gosto (1.ª pess.sing. pres. ind. - verbo gostar)
Conserto ( substantivo) - conserto (1.ª pess.sing. pres. ind. - verbo consertar)


Homófonas heterográficas ( ou homófonas) - são as palavras iguais na pronúncia e diferentes na escrita.
Ex.: cela (substantivo) - sela ( verbo)
Cessão (substantivo) - sessão (substantivo)
Cerrar (verbo) - serrar ( verbo)


Homófonas homográficas ( ou homônimos perfeitos) - são as palavras iguais na pronúncia e na escrita.
Ex.: cura (verbo) - cura ( substantivo)
Verão ( verbo) - verão ( substantivo)
Cedo ( verbo ) - cedo (advérbio)

É a relação que se estabelece entre duas ou mais palavras que possuem significados diferentes, mas são muito parecidas na pronúncia e na escrita - PARÔNIMOS.

Ex.: cavaleiro - cavalheiro
Absolver - absorver
Comprimento - cumprimento


É a propriedade que uma mesma palavra tem de apresentar vários significados.

Ex.: Ele ocupa um alto posto na empresa.
Abasteci meu carro no posto da esquina.

Os convites eram de graça.
Os fiéis agradecem a graça recebida.

Família de Idéias
São palavras que mantêm relações de sinonímia e que representam basicamente uma mesma idéia.

Veja a relação a seguir:

* casa, moradia, lar, abrigo
* residência, sobrado, apartamento, cabana

Todas essas palavras representam a mesma idéia: lugar onde se mora. Logo, trata-se de uma família de idéias.

Observe outros exemplos:

* revista, jornal, biblioteca, livro
* casaco, paletó, roupa, blusa, camisa, jaqueta
* serra, rio, montanha, lago, ilha, riacho, planalto
* telefonista, motorista, costureira, escriturário, professor

Conotação e Denotação

Conotação é o uso da palavra com um significado diferente do original, criado pelo contexto.
Ex.: Você tem um coração de pedra.

Denotação é o uso da palavra com o seu sentido original.
Ex.: Pedra é um corpo duro e sólido, da natureza das rochas.

Etanol e saúde Efeitos das emissões do biocombustível no organismo

Muita gente acha que o biocombustível etanol é uma boa alternativa para substituir o uso de combustíveis fósseis (carvão mineral, gás natural e petróleo). Em maio de 2007, um relatório da ONU apontou os biocombustíveis como alternativas para combater o aquecimento global, que está ocorrendo em decorrência do aumento na atmosfera dos gases ozônio, dióxido de carbono, metano e, principalmente, monóxido de carbono. Esses gases são derivados principalmente da queima de combustíveis fósseis.

Por motivos ambientais e econômicos, já que o preço do petróleo está cada vez mais caro, muitos países estão investindo na produção e na utilização do etanol. O Brasil é o maior produtor e exportador mundial de etanol e consome cerca de 4 bilhões de galões desse combustível por ano.

Os biocombustíveis diminuem a dependência dos combustíveis fósseis, promovem o desenvolvimento da agricultura local e produzem menos gás carbônico, monóxido de carbono e dióxido de enxofre do que os combustíveis fósseis, contribuindo assim para a diminuição da poluição atmosférica e do aquecimento global.

O outro lado da moeda
Apesar de todas as vantagens apresentadas por essa potencial fonte de energia alternativa, alguns cientistas não se deram por satisfeitos e começaram a investigar os efeitos da utilização dos biocombustíveis.

Infelizmente, os resultados dessas pesquisas mostram que as emissões dos biocombustíveis - em particular o etanol - podem causar prejuízos ainda maiores do que os causados pelas emissões da gasolina. Um desses estudos examina os danos causados pelo uso do etanol para a saúde humana.

O dr. Mark Z. Jacobson, da Universidade de Stanford, conduziu um estudo com técnicas de modelagem matemática para simular a qualidade do ar no ano de 2020, supondo que os veículos movidos a etanol serão largamente utilizados nos EUA. Em sua simulação, ele comparou dois cenários: um no qual os veículos eram movidos a gasolina e outro no qual os veículos eram movidos com uma mistura de 85% de etanol e 15% de gasolina.

Os resultados das simulações mostraram que os veículos movidos a etanol reduzem os níveis de dois cancerígenos, o benzeno e o butadieno, mas aumentam os níveis de outros dois cancerígenos, o formaldeído e o acetaldeído. Como resultado, o número de casos de câncer ocasionados pelas emissões dos veículos movidos a etanol seria mais ou menos similar ao número de casos de câncer provocados por emissões de veículos movidos a gasolina.

Aumento do ozônio
Os estudos do dr. Jacobson também mostraram que, em algumas partes dos EUA, os veículos movidos a etanol provocariam um aumento significativo de ozônio. A inalação do ozônio causa diminuição da capacidade pulmonar e inflamação dos tecidos pulmonares, piora a asma e prejudica o sistema imunológico. Nas simulações do dr. Jacobson, os veículos movidos a etanol causaram 4% a mais de mortes relacionadas ao ozônio do que os veículos movidos a gasolina.

Esses resultados são assustadores, já que mais de 2,5 milhões de veículos circulam pelo Brasil movidos a etanol. Os resultados são particularmente temerosos para os habitantes da Região Metropolitana de São Paulo, que, de acordo com relatórios da CETESB (Companhia de Tecnologia de Saneamento Ambiental, ligada à Secretaria do Meio Ambiente do governo do Estado de São Paulo), teve um aumento significativo na concentração de ozônio a partir de 1990.

Apenas tendências
No entanto, devemos analisar os resultados obtidos pelo dr. Jacobson com cuidado, já que, segundo especialistas, os estudos com modelos matemáticos são úteis para indicar tendências e não para obter conclusões precisas, especialmente na área da modelagem de poluição do ar, que é extremamente complexa.

A modelagem matemática se torna ainda mais complexa no caso do ozônio, que não é emitido diretamente pelos veículos, mas produzido a partir da reação química entre hidrocarbonetos (emitidos pelos veículos) e óxidos de nitrogênio (presentes na atmosfera).

Alternativas mais seguras
Como há formas de se obter energia de uma maneira mais segura para a saúde humana e para o meio ambiente, é aconselhável que haja mais investimentos no aperfeiçoamento de novas tecnologias, como, por exemplo, na obtenção de energia eólica e energia solar.

E não podemos esperar muito tempo por esses investimentos, pois já estamos sentindo os efeitos drásticos da poluição atmosférica, causados pela emissão de gases provenientes da queima de combustíveis fósseis e da crise econômica ocasionada pela demanda de tais combustíveis.
*Cynthia Santos é doutora em Ciências e pesquisadora do Smithsonian Institution (EUA).

Pré-inscrições para o Parfor vão até 18 de julho

  Professores devem manifestar interesse nos cursos pela Plataforma CAPES de Educação Básica; cadastro de currículos vai até o dia 13   (Ima...